| Basic information from miRBase |
| hairpin accession number: MI0007343 |
| Located between position 4894122 and 4894203 on chromosome 20 strand + |
| mature miRNAs for MI0007343: |
| gga-miR-1614 (MIMAT0007480): GGCATGGCAGACTCACCCTGC |
| gga-miR-1614* (MIMAT0007481): CAGGGAGGAACTGCCAGCAGA |
| You can find this miRNA in ENTREZGENE: MIR1614 (accession: 100315743) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |