| Basic information from miRBase |
| hairpin accession number: MI0007344 |
| Located between position 6745553 and 6745645 on chromosome 14 strand + |
| Overlapping with sense strand of Q6EE28_CHICK (intron 7). |
| (Ensemble: ENSGALT00000009678) |
| mature miRNAs for MI0007344: |
| gga-miR-1615 (MIMAT0007482): TGGCAGCTGCACAGAAGCCCTTT |
| You can find this miRNA in ENTREZGENE: MIR1615 (accession: 100315962) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |