| Basic information from miRBase |
| hairpin accession number: MI0007345 |
| Located between position 1243998 and 1244091 on chromosome 11 strand - |
| Overlapping with sense strand of LOC415671 (intron 1). |
| (Ensemble: ENSGALT00000003314) |
| mature miRNAs for MI0007345: |
| gga-miR-1616 (MIMAT0007483): TGGATCCTGCAGTTTGCTTTCA |
| You can find this miRNA in ENTREZGENE: MIR1616 (accession: 100315744) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |