| Basic information from miRBase |
| hairpin accession number: MI0007346 |
| Located between position 30615451 and 30615539 on chromosome 5 strand + |
| mature miRNAs for MI0007346: |
| gga-miR-1617 (MIMAT0007484): AGAGGCCTTCAGATACTGTTTT |
| You can find this miRNA in ENTREZGENE: MIR1617 (accession: 100315912) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |