| Basic information from miRBase |
| hairpin accession number: MI0007347 |
| Located between position 7759515 and 7759593 on chromosome 8 strand + |
| mature miRNAs for MI0007347: |
| gga-miR-1618 (MIMAT0007485): GAGCCCGGAGCCAGGCTGCTGT |
| You can find this miRNA in ENTREZGENE: MIR1618 (accession: 100316009) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |