| Basic information from miRBase |
| hairpin accession number: MI0007348 |
| Located between position 12664073 and 12664164 on chromosome 20 strand - |
| mature miRNAs for MI0007348: |
| gga-miR-1619 (MIMAT0007486): AGAATTCATAGCAATACGGACT |
| You can find this miRNA in ENTREZGENE: MIR1619 (accession: 100315745) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |