miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007349
Located between position 19191144 and 19191231 on chromosome 8 strand +
mature miRNAs for MI0007349:
         gga-miR-1620 (MIMAT0007487): ACTTTAATGGGCTTTGGATCAC
You can find this miRNA in ENTREZGENE: MIR1620 (accession: 100315746)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"