| Basic information from miRBase |
| hairpin accession number: MI0007350 |
| Located between position 2706112 and 2706182 on chromosome 28 strand + |
| mature miRNAs for MI0007350: |
| gga-miR-1621 (MIMAT0007488): ACCGGCTGCCTCGGTGGCAC |
| gga-miR-1621* (MIMAT0007489): GGTTCGCCGTGCCGCCGCGC |
| You can find this miRNA in ENTREZGENE: MIR1621 (accession: 100315963) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |