| Basic information from miRBase |
| hairpin accession number: MI0007351 |
| Located between position 40218775 and 40218871 on chromosome 2 strand - |
| Overlapping with sense strand of OSBPL10 (intron 8). |
| (Ensemble: ENSGALT00000018707) |
| mature miRNAs for MI0007351: |
| gga-miR-1622 (MIMAT0007490): CACATATGATGAGTACTGATG |
| You can find this miRNA in ENTREZGENE: MIR1622 (accession: 100315747) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |