| Basic information from miRBase |
| hairpin accession number: MI0007352 |
| Located between position 1395848 and 1395943 on chromosome 10 strand + |
| mature miRNAs for MI0007352: |
| gga-miR-1623 (MIMAT0007491): GCAGGCACAGACAGGCAGTA |
| You can find this miRNA in ENTREZGENE: MIR1623 (accession: 100315748) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |