| Basic information from miRBase |
| hairpin accession number: MI0007353 |
| Located between position 16899106 and 16899180 on chromosome 6 strand - |
| Overlapping with antisense strand of NDST2 (intron 5). |
| (Ensemble: ENSGALT00000008188) |
| mature miRNAs for MI0007353: |
| gga-miR-1624 (MIMAT0007492): ACACCGCACTGGCAGGGAGCA |
| You can find this miRNA in ENTREZGENE: MIR1624 (accession: 100315877) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |