| Basic information from miRBase |
| hairpin accession number: MI0007354 |
| Located between position 7810092 and 7810171 on chromosome 15 strand - |
| Overlapping with sense strand of (intron 12). |
| (Ensemble: ENSGALT00000009103) |
| mature miRNAs for MI0007354: |
| gga-miR-1625 (MIMAT0007493): TGGACCAGGGCTCTTCCTGCTGGCT |
| gga-miR-1625* (MIMAT0007494): GCAGCAGAATATCCCTGCCATT |
| You can find this miRNA in ENTREZGENE: MIR1625 (accession: 100315964) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |