| Basic information from miRBase |
| hairpin accession number: MI0007356 |
| Located between position 40379665 and 40379734 on chromosome 4 strand + |
| mature miRNAs for MI0007356: |
| gga-miR-1627* (MIMAT0007497): GAAGTGACATGTGGTTGATGG |
| gga-miR-1627 (MIMAT0007498): CAGCCACGCTACTGTCACTGGT |
| You can find this miRNA in ENTREZGENE: MIR1627 (accession: 100315749) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |