| Basic information from miRBase |
| hairpin accession number: MI0007357 |
| Located between position 1891993 and 1892089 on chromosome 4 strand + |
| mature miRNAs for MI0007357: |
| gga-miR-1628 (MIMAT0007499): AAGAGCTCTTCCTGTTGTGACC |
| You can find this miRNA in ENTREZGENE: MIR1628 (accession: 100315750) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |