| Basic information from miRBase |
| hairpin accession number: MI0007358 |
| Located between position 1490876 and 1490968 on chromosome 25 strand + |
| mature miRNAs for MI0007358: |
| gga-miR-1629 (MIMAT0007500): TGCTGTCGGTGGGTTTGTTCT |
| You can find this miRNA in ENTREZGENE: MIR1629 (accession: 100315751) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |