| Basic information from miRBase |
| hairpin accession number: MI0007359 |
| Located between position 1883593 and 1883649 on chromosome 9 strand + |
| mature miRNAs for MI0007359: |
| gga-miR-1630 (MIMAT0007501): AAAGAGGAAACTGAAGCTGAAA |
| You can find this miRNA in ENTREZGENE: MIR1630 (accession: 100315878) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |