miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007362
Located between position 144114537 and 144114627 on chromosome 1 strand +
mature miRNAs for MI0007362:
         gga-miR-1632 (MIMAT0007504): TGCTTGTTTTTGGATGAGCTTGC
         gga-miR-1632* (MIMAT0007505): AACTCATTCATTAACCAGCTTTT
You can find this miRNA in ENTREZGENE: MIR1632 (accession: 100315752)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"