| Basic information from miRBase |
| hairpin accession number: MI0007363 |
| Located between position 5554872 and 5554966 on chromosome 8 strand - |
| mature miRNAs for MI0007363: |
| gga-miR-1633 (MIMAT0007506): TGCGCTTCTGCTCAGCTCGGTGT |
| You can find this miRNA in ENTREZGENE: MIR1633 (accession: 100315753) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |