miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007365
Located between position 1720026 and 1720132 on chromosome 21 strand -
Overlapping with sense strand of (intron 1).
(Ensemble: ENSGALT00000001864)
mature miRNAs for MI0007365:
         gga-miR-1635 (MIMAT0007508): TGCCCAGGCTGTGCTGTGCTCTGGG
You can find this miRNA in ENTREZGENE: MIR1635 (accession: 100315942)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"