| Basic information from miRBase |
| hairpin accession number: MI0007366 |
| Located between position 4729959 and 4730046 on chromosome 15 strand + |
| mature miRNAs for MI0007366: |
| gga-miR-1636 (MIMAT0007509): TGCAGGTGATGGCGGGGCTG |
| You can find this miRNA in ENTREZGENE: MIR1636 (accession: 100315966) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |