| Basic information from miRBase |
| hairpin accession number: MI0007367 |
| Located between position 10216005 and 10216069 on chromosome 18 strand - |
| Overlapping with sense strand of (intron 9). |
| (Ensemble: ENSGALT00000031411) |
| mature miRNAs for MI0007367: |
| gga-miR-1637 (MIMAT0007510): TGATAGCTGCTGTGGCACGGA |
| You can find this miRNA in ENTREZGENE: MIR1637 (accession: 100315755) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |