| Basic information from miRBase |
| hairpin accession number: MI0007368 |
| Located between position 58712377 and 58712463 on chromosome 5 strand + |
| Overlapping with antisense strand of KTN1 (intron 6). |
| (Ensemble: ENSGALT00000004057) |
| mature miRNAs for MI0007368: |
| gga-miR-1638 (MIMAT0007511): GTAGTTTGTGTTGTTTGTTT |
| You can find this miRNA in ENTREZGENE: MIR1638 (accession: 100315914) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |