| Basic information from miRBase |
| hairpin accession number: MI0007371 |
| Located between position 3173520 and 3173591 on chromosome 2 strand - |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSGALT00000039135) |
| mature miRNAs for MI0007371: |
| gga-miR-1639 (MIMAT0007514): TTGTGCAAGGTACGTTGGGTT |
| You can find this miRNA in ENTREZGENE: MIR1639 (accession: 100315879) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |