miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007375
Located between position 1919446 and 1919540 on chromosome 11 strand -
Overlapping with sense strand of WDR59_CHICK (intron 3).
(Ensemble: ENSGALT00000004428)
mature miRNAs for MI0007375:
         gga-miR-1643* (MIMAT0007518): TCTTATCACGAGGAGCACTTTT
         gga-miR-1643 (MIMAT0007519): TAAAAGTGCTGCTGGTGGAAGAA
You can find this miRNA in ENTREZGENE: MIR1643 (accession: 100315760)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"