miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007376
Located between position 8284308 and 8284393 on chromosome 14 strand +
Overlapping with sense strand of (intron 4).
(Ensemble: ENSGALT00000010918)
mature miRNAs for MI0007376:
         gga-miR-1644 (MIMAT0007520): TCTGTTGTGCAGGGCTGTGCT
You can find this miRNA in ENTREZGENE: MIR1644 (accession: 100315915)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"