| Basic information from miRBase |
| hairpin accession number: MI0007563 |
| Located between position 4048689 and 4048759 on chromosome 4 strand - |
| mature miRNAs for MI0007563: |
| gga-miR-16c (MIMAT0007739): TAGCAGCACGTAAATACTGGAG |
| You can find this miRNA in ENTREZGENE: MIR16C (accession: 100315901) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |
| [2]Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH, Gene. 418:34-40(2008)., "Identification of novel chicken microRNAs and analysis of their genomic organization" |