| Basic information from miRBase |
| hairpin accession number: MI0007506 |
| Located between position 5834671 and 5834773 on chromosome 15 strand + |
| mature miRNAs for MI0007506: |
| gga-miR-1764* (MIMAT0007671): GCTCAGGCAGCAGGAGGCTTG |
| gga-miR-1764 (MIMAT0007672): AGCTGCTTGTTGGCTGGGGAG |
| You can find this miRNA in ENTREZGENE: MIR1764 (accession: 100315992) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |