| Basic information from miRBase |
| hairpin accession number: MI0007509 |
| Located between position 77321253 and 77321345 on chromosome 2 strand + |
| Overlapping with sense strand of MYO10 (intron 22). |
| (Ensemble: ENSGALT00000021128) |
| mature miRNAs for MI0007509: |
| gga-miR-1766 (MIMAT0007674): GGCAGATGATTGAAAACTGAG |
| You can find this miRNA in ENTREZGENE: MIR1766-2 (accession: 100315895) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |