| Basic information from miRBase |
| hairpin accession number: MI0007510 |
| Located between position 44732913 and 44732971 on chromosome 3 strand + |
| mature miRNAs for MI0007510: |
| gga-miR-1767 (MIMAT0007675): AGGCGAGGAGAACAGCAGCT |
| You can find this miRNA in ENTREZGENE: MIR1767 (accession: 100315829) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |