| Basic information from miRBase |
| hairpin accession number: MI0007511 |
| Located between position 14046710 and 14046786 on chromosome 2 strand + |
| Overlapping with sense strand of (intron 1). |
| (Ensemble: ENSGALT00000011610) |
| mature miRNAs for MI0007511: |
| gga-miR-1768 (MIMAT0007676): GAGCAGAGGATTGTCGTGCTGA |
| You can find this miRNA in ENTREZGENE: MIR1768 (accession: 100315830) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |