| Basic information from miRBase |
| hairpin accession number: MI0007514 |
| Located between position 54133078 and 54133163 on chromosome 5 strand - |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSGALT00000017423) |
| mature miRNAs for MI0007514: |
| gga-miR-1771 (MIMAT0007680): CTCCAAGGCTGTTTCCTCTGA |
| You can find this miRNA in ENTREZGENE: MIR1771 (accession: 100315832) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |