| Basic information from miRBase |
| hairpin accession number: MI0007515 |
| Located between position 11560478 and 11560546 on chromosome 6 strand - |
| Overlapping with sense strand of Q5F401_CHICK (intron 1). |
| (Ensemble: ENSGALT00000006135) |
| mature miRNAs for MI0007515: |
| gga-miR-1772* (MIMAT0007681): CGCTGCCAGCGGAGAACGAGTT |
| gga-miR-1772 (MIMAT0007682): TCGTTGTCTGTTCGGTGGCAG |
| You can find this miRNA in ENTREZGENE: MIR1772 (accession: 100316015) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |