| Basic information from miRBase |
| hairpin accession number: MI0007516 |
| Located between position 8109136 and 8109213 on chromosome 20 strand + |
| mature miRNAs for MI0007516: |
| gga-miR-1773* (MIMAT0007683): TGGGGGAGGAGGGACCTCTGCTT |
| gga-miR-1773 (MIMAT0007684): GGAGAGGCATTGTCCCCTGGA |
| You can find this miRNA in ENTREZGENE: MIR1773 (accession: 100315833) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |