| Basic information from miRBase |
| hairpin accession number: MI0007517 |
| Located between position 3195 and 3273 on chromosome 28_random strand - |
| Overlapping with sense strand of SAFB2 (intron 15). |
| (Ensemble: ENSGALT00000003015) |
| mature miRNAs for MI0007517: |
| gga-miR-1774 (MIMAT0007685): CCCCTGCTGAGGTTCTGCTTC |
| You can find this miRNA in ENTREZGENE: MIR1774 (accession: 100315931) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |