| Basic information from miRBase |
| hairpin accession number: MI0007518 |
| Located between position 2488503 and 2488591 on chromosome 5 strand + |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSGALT00000005993) |
| mature miRNAs for MI0007518: |
| gga-miR-1775 (MIMAT0007686): TCCTGTAGCCAGAAGATTCTGA |
| You can find this miRNA in ENTREZGENE: MIR1775 (accession: 100315994) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |