| Basic information from miRBase |
| hairpin accession number: MI0007520 |
| Located between position 2555498 and 2555592 on chromosome 28 strand + |
| Overlapping with antisense strand of (exon 3). |
| (Ensemble: ENSGALT00000024511) |
| mature miRNAs for MI0007520: |
| gga-miR-1777 (MIMAT0007688): GTGGGCGGTGCGGGGCGGCG |
| You can find this miRNA in ENTREZGENE: MIR1777 (accession: 100315835) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |