| Basic information from miRBase |
| hairpin accession number: MI0007524 |
| Located between position 3330762 and 3330854 on chromosome 14 strand - |
| Overlapping with sense strand of IQCE (intron 25). |
| (Ensemble: ENSGALT00000006902) |
| mature miRNAs for MI0007524: |
| gga-miR-1781* (MIMAT0007692): AACAGCTGAGTGATTTAAAGCA |
| gga-miR-1781 (MIMAT0007693): TTTAAATCATGCAGCTGTTGA |
| You can find this miRNA in ENTREZGENE: MIR1781 (accession: 100315995) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |