| Basic information from miRBase |
| hairpin accession number: MI0007526 |
| Located between position 9044610 and 9044710 on chromosome 12 strand + |
| Overlapping with sense strand of Q90634_CHICK (intron 12). |
| (Ensemble: ENSGALT00000033710) |
| mature miRNAs for MI0007526: |
| gga-miR-1783 (MIMAT0007695): TGCTCTGAACGAGCTGAGAGGCA |
| You can find this miRNA in ENTREZGENE: MIR1783 (accession: 100315838) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |