| Basic information from miRBase |
| hairpin accession number: MI0007531 |
| Located between position 23909930 and 23910017 on chromosome 7 strand + |
| mature miRNAs for MI0007531: |
| gga-miR-1788-5p (MIMAT0007700): GGCTTGTTTTCCGTTGCCTGCG |
| gga-miR-1788-3p (MIMAT0007701): CAGGCAGCGAAAGCAAGTCTG |
| You can find this miRNA in ENTREZGENE: MIR1788 (accession: 100315840) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |