| Basic information from miRBase |
| hairpin accession number: MI0007532 |
| Located between position 9553017 and 9553079 on chromosome 11 strand + |
| mature miRNAs for MI0007532: |
| gga-miR-1789 (MIMAT0007702): TGGGTGTACTTGCGGATGAATG |
| You can find this miRNA in ENTREZGENE: MIR1789 (accession: 100315841) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |