| Basic information from miRBase |
| hairpin accession number: MI0007533 |
| Located between position 11666887 and 11666991 on chromosome 4 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSGALT00000012248) |
| mature miRNAs for MI0007533: |
| gga-miR-1790 (MIMAT0007703): CGGGTGAGGGCGGTGGGGGA |
| You can find this miRNA in ENTREZGENE: MIR1790 (accession: 100316016) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |