miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007534
Located between position 9633722 and 9633806 on chromosome 11 strand +
mature miRNAs for MI0007534:
         gga-miR-1791* (MIMAT0007704): TGGGCTGCATCAGTCATGCCATG
         gga-miR-1791 (MIMAT0007705): GCGATGTGACTGATGCAGGCTG
You can find this miRNA in ENTREZGENE: MIR1791 (accession: 100315997)

References
[1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach"