| Basic information from miRBase |
| hairpin accession number: MI0007535 |
| Located between position 7712006 and 7712104 on chromosome 3 strand + |
| Overlapping with sense strand of GALNT14 (intron 1). |
| (Ensemble: ENSGALT00000014770) |
| mature miRNAs for MI0007535: |
| gga-miR-1792 (MIMAT0007706): GCGATAGCTCAGGAACACTGCAG |
| You can find this miRNA in ENTREZGENE: MIR1792 (accession: 100315842) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |