| Basic information from miRBase |
| hairpin accession number: MI0007536 |
| Located between position 25115521 and 25115617 on chromosome 9 strand - |
| Overlapping with antisense strand of GPR87 (intron 1). |
| (Ensemble: ENSGALT00000016905) |
| mature miRNAs for MI0007536: |
| gga-miR-1793 (MIMAT0007707): TGTAAGGAGCAGAAGTGTGAAGC |
| You can find this miRNA in ENTREZGENE: MIR1793 (accession: 100315843) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |