| Basic information from miRBase |
| hairpin accession number: MI0007537 |
| Located between position 1926428 and 1926525 on chromosome 10 strand + |
| Overlapping with sense strand of Q0Q5V3_CHICK (intron 10). |
| (Ensemble: ENSGALT00000002152) |
| mature miRNAs for MI0007537: |
| gga-miR-1794 (MIMAT0007708): GCCAGAATGGACATGGGCAGCAA |
| You can find this miRNA in ENTREZGENE: MIR1794 (accession: 100315844) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |