| Basic information from miRBase |
| hairpin accession number: MI0007538 |
| Located between position 2359869 and 2359946 on chromosome 21 strand + |
| Overlapping with antisense strand of PUSL1 (intron 2). |
| (Ensemble: ENSGALT00000002630) |
| mature miRNAs for MI0007538: |
| gga-miR-1795 (MIMAT0007709): GCAAGATGAAGAACAGGCCTGT |
| You can find this miRNA in ENTREZGENE: MIR1795 (accession: 100315934) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |