| Basic information from miRBase |
| hairpin accession number: MI0007540 |
| Located between position 2086591 and 2086691 on chromosome 26 strand - |
| Overlapping with sense strand of RAB7L1 (intron 5). |
| (Ensemble: ENSGALT00000001008) |
| mature miRNAs for MI0007540: |
| gga-miR-1797 (MIMAT0007711): GCTTGGAACTGAGCAGGAACTG |
| You can find this miRNA in ENTREZGENE: MIR1797 (accession: 100315998) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |