| Basic information from miRBase |
| hairpin accession number: MI0007542 |
| Located between position 9654914 and 9655009 on chromosome 20 strand - |
| Overlapping with sense strand of (intron 18). |
| (Ensemble: ENSGALT00000039433) |
| mature miRNAs for MI0007542: |
| gga-miR-1798* (MIMAT0007713): AACGTGACACTTTAGAAAAC |
| gga-miR-1798 (MIMAT0007714): TGGTTTTCAGAAGTGTAGCGTT |
| You can find this miRNA in ENTREZGENE: MIR1798 (accession: 100315846) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |