| Basic information from miRBase |
| hairpin accession number: MI0007543 |
| Located between position 42365934 and 42366017 on chromosome 5 strand + |
| Overlapping with sense strand of (intron 12). |
| (Ensemble: ENSGALT00000017123) |
| mature miRNAs for MI0007543: |
| gga-miR-1799 (MIMAT0007715): TGAAGTGATGATGCCTGATTA |
| You can find this miRNA in ENTREZGENE: MIR1799 (accession: 100315847) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |