| Basic information from miRBase |
| hairpin accession number: MI0007544 |
| Located between position 47604931 and 47605006 on chromosome 5 strand + |
| Overlapping with sense strand of LOC423425 (intron 1). |
| (Ensemble: ENSGALT00000017631) |
| mature miRNAs for MI0007544: |
| gga-miR-1800 (MIMAT0007716): ACTACGTGATGCGATCTGATG |
| You can find this miRNA in ENTREZGENE: MIR1800 (accession: 100315999) |
| References |
| [1]Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML, Genome Res. 18:957-964(2008)., "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" |